Home     About SciClips     Contact Us     Register     Login     Upload Videos    
Open Innovation Platform for Scientific Breakthroughs, Collaborations and Philanthropism
Advertise | Consultancy
 
  Stem Cell Research | Proteomics / Biomarkers / Metabolomics | Drug Discovery | Biofuels | Tuberculosis | Mosquito-Borne Diseases
Visit our section on
Bioprotocols
Biomarker Discovery Protocols: This database contains a comprehensive list of various bioprotocols that are used in biomarker discovery. These complete protocols include techniques used in molecular and protein biomarker discovery research. We have listed unique protocols that are not available in any other online bioprotocol database.
Molecular Biomarker Discovery Protocols

Telomeric Repeat Amplification Protocol (TRAP) assay



Telomerase activity from cell extracts was analyzed using a previously described realtime PCR-based telomeric repeat amplification protocol (TRAP) (Xu T, Xu Y, Liao CP, Lau R, Goldkorn A. Reprogramming murine telomerase rapidly inhibits the growth of mouse cancer cells in vitro and in vivo. MoI Cancer Ther 2010;9:438-49). The microfilter with captured cells was lysed in TRAPeze® IX CHAPS Lysis Buffer (Millipore, 5 Temecula, CA), and 5 micro liter of cell lysate per reaction was added for each sample. For each reaction, DU 145 cell lysates were used as standard controls in parallel.

QPCR telomerase activity assay was carried out as described below.

1. TS oligonuleotides (5' AATCCGTCGAGCAGAGTT, 8ng/micro liter) and 50micro molar of each dNTPs are added to the cell lysate and incubated on a Bio-Rad MyiQ Thermocycler system for 30 min at 30 °C followed by inactivation of telomerase at 95 0C for 1 min.2. ACX reverse primer (5'GCGCGGCTTACCCTTACCCTTACCCTAACC, 4ng/micro liter), SYBR green (1 :20,000) and 0.8U Taq platinum polymerase (Invitrogen, Carlsbad, CA) are added to the same tube in a master mix formula.

The reaction is run on the same machine for 40 cycles at 95 0C, 0"; 50 0C, 5"; 72 0C, 10", and the iQ5 optical system software version 2.0 was used to analyze the results.



Source: WO/2010/135603



Disclaimer: Sciclips does not guarantee the authenticity or validity of the protocols listed in this section. These protocols are extracted "as is" from various sources, with minor modifications. Please refer to the respective citations, which are hyperlinked, for more details. The use of cited molecules, not limited to proteins, nucleic acids, compounds etc, in the protocols that are extracted from patents may be covered under patent rights. These molecules should be used for information purpose only.
Search Biomarker Database
This feature is available only to customers who have subscribed to premium membership. If you have subscribed to our premium membership please login to access this feature. If you wish to signup for Sciclips/subscribe to our premium membership, please click here. You will need a Sciclips account to subscribe.
Services offered

SciClips Consultancy

Fostering innovation through scientific intelligence
Sciclips consultancy service team is comprised of highly qualified and experienced scientists who have several years of research experience in academic and industrial laboratories. We offer following custom services at competitive price:

Scientific and technical areas covered: Drug discovery, Stem cells, Genomics, Proteomics, Biomarkers, Clinical diagnostics, Companion diagnostics, Molecular diagnostics, Personalized medicine (theranostics), Plant and agricultural biotechnology

Patent search

: Custom intellectual property (IP) analysis; Comprehensive patent database search and evaluation

Custom data analysis and data mining

: From patents, research articles, meeting abstracts and web based information. Custom meta analysis.

Competitive intelligence analysis

: Comprehensive analysis of competitive technologies and products; Technology trend prediction; Identification of technology licensing opportunities; Acquisition target identification; Identification of collaborative technology development opportunities.

Technology development

: Identification of potential development opportunities in drug discovery assay development, cell based assay development, recombinant protein expression (in vitro and in vivo) and mass spectrometry/proteomics reagents and tools; Product development strategy.

Diagnostics and Theranostics technology development

: Diagnostic assay development; Diagnostic target identification (molecular or protein or miRNA or metabolomic biomarkers); Prognostic and drug efficacy biomarkers; Theranostics tools, biomarkers and therapeutic drug targets; Identification of emerging technologies and methods.

Custom database development

Customized bioinformatics tools

: Offered through our partners.

Proteomics and Drug discovery services (laboratory based)

: Offered through our partners.

For more information on our consultancy services please contact us at contact@sciclips.com or email us using the contact form
Receive news updates by email
If you would like to receive news updates by email, please sign up below by entering your Name and Email address and clicking Sign Up
Name:
Email:
Keywords: Tissue Microarrays, Tissue Arrays,Tissue Arrayer,Tissue Microarray Slides,FFPE tissue, Frozen Human Tissue,Cancer Tissue, research tissue, Monoclonal Antibodies,Antibody Labeling, Antibody Detection,Secondary Antibodies,Primary Antibodies,Antibody Assay,Protein Quantification,Proteomics,protein mass spectrometry,peptide mass spectrometry,peptide fractionation,MALDI-TOF,LC-MS/MS,Quantitative proteomics,Post Translational Modification,phosphoproteins,phosphopeptides,glycopeptide isolation,phosphoprotein isolation,peptide quantitation,trypsin digestion,chymotrypsin,Endoproteinase, Proteomics Software, Proteomics tools, mass spectrometry software,MALDI matrix,MALDI sample preparation,peptide analysis,peptide idetification,peptide mapping,peptide characterization,peptide isolation,protein sequencing,peptide sequencing,peptide labeling,peptide modification,custom proteomics, tandem affinity purification, affinity purification, yeast two-hybrid, yeast three-hybrid, protein sequencing,genotyping,next generation sequencing, RNA sequencing, parallel sequencing, genome sequencing,exon sequencing, sequencing assembly, sequencing software, SNP sequencing, genotype sequencing, transcriptome sequencing, Pyrosequencing, exome sequencing, Genome Wide Association


 
SciClips LLC, 1202 Ann Street, Madison, WI 53713 USA; contact@sciclips.com
Privacy Policy All Rights Reserved 2009-2014.